KuwaitTender notice for Primer CD26G-AHB E N-TAA CCTTGATACCAACCTGCCCAGGGCGTC, Qty: 2 Nos, (BOQ Item #12). The reference ID of the tender is 120669000 and it is closing on 03 Jul 2025.
If you are registered member, kindly login to view full details of this tender notice:
CLICK HERE TO LOGINFresh and verified Tenders from Kuwait. Find, search and filter Tenders/Call for bids/RFIs/RFPs/RFQs/Auctions published by the government, public sector undertakings (PSUs) and private entities.
Fill out the form below and you will receive a call from us within 24 hours.
Get FREE SAMPLE TENDERS from Kuwait in your email inbox.
Copyright © 2014-2025 KuwaitTender.com. All Rights Reserved.